View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_high_106 (Length: 222)
Name: NF14784_high_106
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_high_106 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 31528725 - 31528552
Alignment:
| Q |
1 |
tcatttcttctttatctcaatcactgtctttgatcctcttcttcatcttcttcgcagattcatgggtagattgtttgtgatcaatttggaaggtaagatc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528725 |
tcatttcttctttatctcaatcaatgtctttgatcctcttcttcatcttcttcgcagattcatgggtagattgtttgtgatcaatttggaaggtaagatt |
31528626 |
T |
 |
| Q |
101 |
tattcctgcagatactgtcgcacccatcttgctttatatgaagacatcgtttccaaggttcctttttctctctc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528625 |
tattcctgcagatactgtcgcacccatcttgctttatatgaagacatcgtttccaaggttcctttttctctctc |
31528552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University