View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_high_115 (Length: 205)
Name: NF14784_high_115
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_high_115 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 184
Target Start/End: Original strand, 6033380 - 6033544
Alignment:
| Q |
20 |
atgaatgaaaagaaaaggaatgagctaatctaaatagaaagaaataacaacattcttcaacaaccaaattaatcatcatgggttcggtagaacgagggaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6033380 |
atgaatgaaaagaaaaggaatgagctaatctaaatagaaagaaataacaacgttcttcaacaaccaaattaatcatcatgggttcggtagaacgagggaa |
6033479 |
T |
 |
| Q |
120 |
gatccattggagcgtatacgacggcgtaaagataatcgctgcaacaccagaagctctgatgtcag |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6033480 |
gatccattggagcgtatacgacggcgtaaagataatcgctgcaacaccagaagctctgatgtcag |
6033544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University