View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_high_68 (Length: 288)
Name: NF14784_high_68
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_high_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 94 - 272
Target Start/End: Original strand, 12692141 - 12692319
Alignment:
| Q |
94 |
gtaaaccaatactttagtttgaaatatatgggactaaaccaatacaagtattttagtttgaaatattaattctttaattaaattaacgaggggatattgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12692141 |
gtaaaccaatactttagtttgaaatatgtgggactaaaccaatacaagtattttagtttgaaatattaattctttaattaaattaacgaggggatattgt |
12692240 |
T |
 |
| Q |
194 |
tagctcattgcccgtcaccggaacataatcacatcatccctttcatacctacaactgacaaagaaaccaatgtaaagaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12692241 |
tagctcattgcccgtcaccggaacataatcacatcatccctttcatacctacaactgacaaagaaaccaatgtaaagaa |
12692319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University