View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_high_82 (Length: 257)
Name: NF14784_high_82
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_high_82 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 697567 - 697326
Alignment:
| Q |
1 |
tttcccttcttatttattattaagcgaatggtttgcgttggaatcatcgtcgacagcaccctcagtgccaacaacattttcttcttgtgcgtaggggaac |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
697567 |
tttcccttcttatttattattaagctaatggtttgcgttggaatcatcgacgacagcaccctcagtgccaacaacattttcttcttgtgcgcaggggaac |
697468 |
T |
 |
| Q |
101 |
acaagagggttgttgaactgttgaatttctctaacgagtttatcgacagaggctttgatagacatatcgtgtaaggaaaggcagacaatggaagcacatt |
200 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
697467 |
acaggagggttgtcgaactgttgaatttctctaacgagtttatcgacagaggctttgatagacatatcgtgcaatgaaaggcagacaatggaagcacatt |
697368 |
T |
 |
| Q |
201 |
ggcgcctctaaatcggtgatagccgctatgaattccaacttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
697367 |
ggcgcctctaaatcggtgatagccgcaatgaattccaacttg |
697326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University