View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_high_97 (Length: 236)
Name: NF14784_high_97
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_high_97 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40836432 - 40836212
Alignment:
| Q |
1 |
ttgatcttatattttcaatgataacgatccataagatttagcgtctctttgataaaatgtaaaagatgatgatttgagatttctgagactacaccattcc |
100 |
Q |
| |
|
||||||||||| ||| |||||| ||||||||||||||||| |||||||||||||| |||||||| || ||||||| |||||||||| ||| ||||||||| |
|
|
| T |
40836432 |
ttgatcttatacttttaatgatcacgatccataagatttaacgtctctttgataagatgtaaaatatcatgatttaagatttctgaaacttcaccattcc |
40836333 |
T |
 |
| Q |
101 |
caccaccctgagtgattttgtctccactctatgagaattgatacctaggtcacatgccaacctcaaaccataaacaagaccccaaagctcaaccatagtt |
200 |
Q |
| |
|
||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40836332 |
caccagcgtgagtgattttgtctccactctatgagaattgatacctaggtcacatgccaacctcaaaccataaacaagaccccaaaactcaaccatagtt |
40836233 |
T |
 |
| Q |
201 |
gaagtagaaccaccatgaata |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40836232 |
gaagtagaaccaccatgaata |
40836212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 73 - 197
Target Start/End: Complemental strand, 28559433 - 28559309
Alignment:
| Q |
73 |
tttgagatttctgagactacaccattcccaccaccctgagtgattttgtctccactctatgagaattgatacctaggtcacatgccaacctcaaaccata |
172 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| |||| | | |||| ||| || | |||||||||| |||| |||||||||||||||||||| |
|
|
| T |
28559433 |
tttgagattttcgagacttcaccattcccaccaccgtgagatagtccatctctactataaaaaaattgatacccaggttacatgccaacctcaaaccatg |
28559334 |
T |
 |
| Q |
173 |
aacaagaccccaaagctcaaccata |
197 |
Q |
| |
|
||||||||||||||| ||| ||||| |
|
|
| T |
28559333 |
aacaagaccccaaagttcagccata |
28559309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 197
Target Start/End: Original strand, 45013025 - 45013061
Alignment:
| Q |
161 |
cctcaaaccataaacaagaccccaaagctcaaccata |
197 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
45013025 |
cctcaaaccatatacaagaccccaaagttcaaccata |
45013061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University