View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_high_98 (Length: 235)
Name: NF14784_high_98
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_high_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 217
Target Start/End: Original strand, 39328021 - 39328230
Alignment:
| Q |
8 |
taagtatcattttggatcacgcactacaatcgtataagtgtacaaactcttgggttcatcgtctgcttttgggtacaagtgtccaatcattgtagtacaa |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39328021 |
taagtatcgttttggatcacgcactacagtcgtataagtgtacaaactcttgggttcatcgtctgcttttgggtacaagtgtccaatcattgtagtacaa |
39328120 |
T |
 |
| Q |
108 |
ggaatacaaaaatatgattagtgccaagaggataatataagctagggacaacttatagaagaaacgaccaaatggtacaattgggtgagcaatggcgagg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39328121 |
ggaatacaaaaatatgattagtgccaagaggataatataagctagggacaacttatagaagaaacgaccaaatggtacaattgggtgagcaatggcgagg |
39328220 |
T |
 |
| Q |
208 |
gagaaggctt |
217 |
Q |
| |
|
|||||||||| |
|
|
| T |
39328221 |
gagaaggctt |
39328230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University