View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_112 (Length: 226)
Name: NF14784_low_112
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_112 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 149 - 210
Target Start/End: Original strand, 27841854 - 27841915
Alignment:
| Q |
149 |
tgaagacatttggtacccaagtaacagatcttccaatcaccaatccaagctagtggtgaatg |
210 |
Q |
| |
|
|||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27841854 |
tgaagacatttggtacacgagtaacagatattccaatcaccaatccaagctagtggtgaatg |
27841915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University