View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_118 (Length: 211)
Name: NF14784_low_118
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_118 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 33727766 - 33727588
Alignment:
| Q |
15 |
cataggtcaaatttctgataaacaaattcatcgtaaagttaacttacttggaagaatccatgggtcaaatttgtagagatcaatttcagcaatgatttga |
114 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33727766 |
catacgtcaaatttctgataaacatattcatcgtaaagttaacttacttggaagaatccatgggtcgaatttgtagagatcaatttcagcaatgatttga |
33727667 |
T |
|
| Q |
115 |
agagaaaaatgatgaccagctactttacgacatagatattgaacaagaagctcttcatcagtggggtaaaatctaaaac |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33727666 |
agagaaaaatgatgaccagctactttgcgacatagatattgaacaagaagctcttcatcagtggggtaaaatctaaaac |
33727588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 58 - 193
Target Start/End: Complemental strand, 20701284 - 20701149
Alignment:
| Q |
58 |
ttacttggaagaatccatgggtcaaatttgtagagatcaatttcagcaatgatttgaagagaaaaatgatgaccagctactttacgacatagatattgaa |
157 |
Q |
| |
|
|||| |||||||| ||| || |||||||| || | ||||||||||||||| ||| | | |||||||||||| || || |||||||||||||||||||||| |
|
|
| T |
20701284 |
ttacctggaagaacccaaggatcaaatttatacaaatcaatttcagcaataattggcaaagaaaaatgatgtcctgcaactttacgacatagatattgaa |
20701185 |
T |
|
| Q |
158 |
caagaagctcttcatcagtggggtaaaatctaaaac |
193 |
Q |
| |
|
|||||||||| |||||||||||| | ||||| |||| |
|
|
| T |
20701184 |
caagaagctcctcatcagtggggaagaatctgaaac |
20701149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University