View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_121 (Length: 210)
Name: NF14784_low_121
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_121 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 6 - 193
Target Start/End: Original strand, 38452342 - 38452529
Alignment:
| Q |
6 |
agtaaaaactgaaccatagccgcaaaattggttccttctcttaattaggagtaattcctaactacattaactacttgatggcaacttctcattcgatcca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38452342 |
agtaaaaactgaaccatagccgcaaaattggttccttctcttaattaggagtaattcctaactacattaactacttgatggcaacttctcattcgatcca |
38452441 |
T |
 |
| Q |
106 |
acctttctcattgattcttacatatgaatatagaatgagaacaagcaattgttgcaggccaaataattcacattgctacccttcgttc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38452442 |
acctttctcattgattcttacatatgaatatagaatgagaacaagcaattgttgcaggccaaataattcacattgctacccttagttc |
38452529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University