View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_44 (Length: 354)
Name: NF14784_low_44
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 160 - 334
Target Start/End: Complemental strand, 4604984 - 4604810
Alignment:
| Q |
160 |
ggcatcaataaggtttgggccggttctcgcttcgctgttcctataaaggccgcggctgtttttagttctaattatgatgacagttctgagctaagccgga |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||| | ||||||| ||||||||||| |||||| ||||| | | ||||||||||||||||||||||| |||| |
|
|
| T |
4604984 |
ggcatcaataagtgttgggccggttctcgcctttctgttccaataaaggccgcagctgttattagtacgacatatgatgacagttctgagctaagtcgga |
4604885 |
T |
|
| Q |
260 |
gcagttttccggaaggttttgtttttggtactggctcctccaattaccaggtacgttttgtaacattgtgtgtgt |
334 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4604884 |
gcagtttcccggaaggttttgtttttggtactggctcctccaattaccaggtacattttgtaacattgtgtgtgt |
4604810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 232 - 332
Target Start/End: Complemental strand, 4627389 - 4627289
Alignment:
| Q |
232 |
tatgatgacagttctgagctaagccggagcagttttccggaaggttttgtttttggtactggctcctccaattaccaggtacgttttgtaacattgtgtg |
331 |
Q |
| |
|
|||| ||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4627389 |
tatgctgatagttttgagctaaatcggagcagttttccggaaggttttgtttttggtactggctcctccaattaccaggtacgttttgtaacattgtgtg |
4627290 |
T |
|
| Q |
332 |
t |
332 |
Q |
| |
|
| |
|
|
| T |
4627289 |
t |
4627289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 233 - 299
Target Start/End: Original strand, 18792973 - 18793039
Alignment:
| Q |
233 |
atgatgacagttctgagctaagccggagcagttttccggaaggttttgtttttggtactggctcctc |
299 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||||| ||||||| ||||| ||||||| |||||| |
|
|
| T |
18792973 |
atgatgacagttctgatctaagtcggagtagttttccgaaaggtttcgttttcggtactgcctcctc |
18793039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University