View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_66 (Length: 298)
Name: NF14784_low_66
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 280
Target Start/End: Complemental strand, 32856244 - 32855984
Alignment:
| Q |
20 |
tatttgagcctgatgaaagtatggcttacaatgttgggttgtcttcttttgcaaagtcatcaaatccttctacttcaatttctcttgcctcctctgccac |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32856244 |
tatttgagcctgatgaaagtatgacttacaatgttgggttgtcttcttttgcaaagtcatcaaatccttctacttcaatttctcttacctcctctgccac |
32856145 |
T |
 |
| Q |
120 |
taggacaaaggtnnnnnnnnngagtaaaaacattttatttttcttttccaataatacacaacttatttagcttatattaaaatttttgtgatagaaaatg |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856144 |
taggacaaaggtaaaaaaaaagagtaaaaacattttatttttcttttccaataatacacaacttatttagcttatattaaaatttttgtgatagaaaatg |
32856045 |
T |
 |
| Q |
220 |
aaaatgtaatttagatcatgattattggtatctttgaagtacatgcaaattgtgggtatat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856044 |
aaaatgtaatttagatcatgattattggtatctttgaagtacatgcaaattgtgggtatat |
32855984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University