View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_68 (Length: 297)
Name: NF14784_low_68
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_68 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 17 - 287
Target Start/End: Original strand, 9666262 - 9666532
Alignment:
| Q |
17 |
aattttcaaggtgtatgtgatgatgggtctgtgggagatggtgggggtagttcagtaatttcaccaattccgcctagaacgatccatgatgttgggttgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666262 |
aattttcaaggtgtatgtgatgatgggtctgtgggagatggtgggggtagttcagtaatttcaccaattccgcctagaacgatccatgatgttgggttgg |
9666361 |
T |
|
| Q |
117 |
tgagatttggtgttggttgtgaaaatgggaaggtgggaagcggtggaatgagttcagttatttcaccaatgccgcctagaacggttgacgatgatgagtc |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
9666362 |
tgagatttggtgttggatgtgaaaatgggaaggtggaaagcggtggaatgagttcagttatttcaccagtgccgcttagaacggttgacgatgatgagtc |
9666461 |
T |
|
| Q |
217 |
ggtgagttttggtgtgggatgtgagtgtgaaggtatttgtgatgatgagtgtatgtgtttttctgatgatg |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666462 |
ggtgagttttggtgtgggatgtgagtgtgaaggtatttgtgatgatgagtgtatgtgtttttctgatgatg |
9666532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University