View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_82 (Length: 267)
Name: NF14784_low_82
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_82 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 3186414 - 3186666
Alignment:
| Q |
16 |
atatttttcaagttacgtgtatgataacctttcnnnnnnngttacatgtatgatttagcnnnnnnnttaattaacatgtatttggtcctcaccctctcnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3186414 |
atatttttcaagttacgtgtatgataacctttcaaaaaaagttacatgtatgatttagcaaaaaaattaattaacatgtatttggtcctcaccctctcaa |
3186513 |
T |
 |
| Q |
116 |
nnnnn-gttgtatttggtcctcataaaaatgnnnnnnnatttgaattatgtacaaattttatttgaatcattgatatttgatatatacaacaattttatt |
214 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3186514 |
aaaaaagttgcatttggtcctcataaaaatgtttttttatttgaattatgtacaaattttatttgaatcattgatatttgatatatacaacaattttatt |
3186613 |
T |
 |
| Q |
215 |
tgtttttattcnnnnnnnnnttatgtgtttattattcttttagtctatgtaat |
267 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3186614 |
tgtttttattcaaaaaaaaattatgtgtttattattcttttagtctatgtaat |
3186666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University