View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_87 (Length: 258)
Name: NF14784_low_87
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_87 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 30575866 - 30575615
Alignment:
| Q |
1 |
gtgaatgtcactatttctccacagtttttgctatttttcccatttcgttctttccggcactgtcaagtgtcaactgatatttcttccttttgatttctta |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30575866 |
gtgaatgtcactatttctcca--gtttttgctatttttcccatttcgttctttccggcactgtcaagtgtcaactgatatttcttccttttgatttctta |
30575769 |
T |
 |
| Q |
101 |
ttcttttgtttccaccatctctgtggaataagaaccaagtgtattttttgactgagttaccgtgttttctaattcatgtgagaaatgttttaccgtatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30575768 |
ttcttttgtttccaccatctctgtggaataagaaccaagtgtattttttgactgagttactgtgttttcaaattcatgtgagaaatgttttaccgtatcc |
30575669 |
T |
 |
| Q |
201 |
ttggttgggttgtcactattaatgccgttggtttggtcacatatttctttgcct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30575668 |
ttggttgggttgtcactattaatgccgttggtttggtcacatatttctttgcct |
30575615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University