View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_98 (Length: 241)
Name: NF14784_low_98
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_98 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 223
Target Start/End: Complemental strand, 6174447 - 6174242
Alignment:
| Q |
15 |
caaaggagtagttaatataagacgggaaatgacggatggataagtaactatttttaaccttaagaaccacaaataaacagtcttgctactgttcttcctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6174447 |
caaaggagtagttaatataagacgggaaatgacggatggataagtaactatttttaaccttaagaaccacaaataaacagtcttgctactgttcttcctc |
6174348 |
T |
|
| Q |
115 |
ttgttattgctgttttgcttctaatcgtgttcctgtttctgccatgtcagtcgagtggactagagctgcacgctctacactacgtgtcgtataccacatg |
214 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6174347 |
ttg---ttgctgttttgcttctaatggtgttcctgtttctgccatgtcagtcgagtggactagagctgcacgctctacactacgtgtcgtataccacatg |
6174251 |
T |
|
| Q |
215 |
aggcacatc |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
6174250 |
aggcacatc |
6174242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University