View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_low_99 (Length: 240)
Name: NF14784_low_99
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_low_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 143 - 225
Target Start/End: Original strand, 35331662 - 35331749
Alignment:
| Q |
143 |
tgttccaatgccttttgtcagctaaatgttccagttcttatgg-----taagctgcataaaattaaagtaaactaaaacctccctatg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35331662 |
tgttccaatgccttttgtcagctaaatgttccagttcttatggttaaataagctgcataaaattaaagtaaactaaaacctccctatg |
35331749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 20 - 77
Target Start/End: Original strand, 35331537 - 35331596
Alignment:
| Q |
20 |
gaaaagagcagggtggcaaaacaattttcacttcacatatgaaaca--ccaaattttcag |
77 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35331537 |
gaaaagagcaggatggcaaaacaattttcacttcacatatgaaacactccaaattttcag |
35331596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University