View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14785_high_7 (Length: 296)
Name: NF14785_high_7
Description: NF14785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14785_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 179 - 278
Target Start/End: Complemental strand, 46556909 - 46556810
Alignment:
| Q |
179 |
gtgatggagaaagcagtgatgaaggtaaccaaaccgatggtggcaacgaaaacgaagctgttaaggttgttgttgctgctaccgaaggtggtagtggtgg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46556909 |
gtgatggagaaagcagtgatgaaggtaaccaaaccgatggtggcaacgaaaacgaagctgttaaggttgttgttgctgctaccgaaggtggtagtggtgg |
46556810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 9 - 102
Target Start/End: Complemental strand, 46557079 - 46556986
Alignment:
| Q |
9 |
agaagcaaaggggactgtcgacaccgatacactgattaagatactaacacaaaccggtaaacgagctgagttatggcctgatacagaaccaatc |
102 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557079 |
agaagtaaaggggactgtcgacaccgatacactgattaagatactaacacaaaccggtaaacgagctgagttatggcctgatacagaaccaatc |
46556986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University