View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14785_high_8 (Length: 235)
Name: NF14785_high_8
Description: NF14785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14785_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 39749914 - 39749706
Alignment:
| Q |
12 |
attctaggatctactattattgtactgcatgcaccgcaagagatgtcgcttagttctgtacaacagatatggaaattggccattcaaccaggtattcttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39749914 |
attctaggatctactattattgtactgcatgcaccgcaagagatgtcgcttagttctgtacaacagatatggaaattggccattcaaccaggtattcttc |
39749815 |
T |
 |
| Q |
112 |
tattgtgccataatgcccgagcctatacgattcatgtaattttcctgattattgctttcnnnnnnnggcctacagcatttctcatgtacacgacctctgc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39749814 |
tattgtgccataatgcccgagcctatacgattcatgtaattttcctgattattgctttctttttttggcctacagcatttctcatgtacacgacctctgc |
39749715 |
T |
 |
| Q |
212 |
tattgccat |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
39749714 |
tattgccat |
39749706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University