View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14785_low_5 (Length: 373)
Name: NF14785_low_5
Description: NF14785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14785_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 138 - 357
Target Start/End: Complemental strand, 12779468 - 12779249
Alignment:
| Q |
138 |
ttgctaagactgcaaatctctagactcagcccttattttcaataatgacattactcaagtgattagcatttaaacaaccaatgaattaaactttcaaaat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12779468 |
ttgctaagactgcaaatctctagactcagcccttattttcaataatgacattactcaagtgattagcatttaaacaaccaatgaattaaactttcaaaat |
12779369 |
T |
 |
| Q |
238 |
gatcttcttatcaaatttggtgatcattcatttcttcactttcttcatctctaaatatcaatttttgtaggtataagaatttcaaactgacttgtgcagc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12779368 |
gatcttcttatcaaatttggtgatcattcatttcttcactttcttcatctctaaatatcaatttttgtaggtataagaatttcaagctgacttgtgcagc |
12779269 |
T |
 |
| Q |
338 |
tgctaaaaaatttaccatat |
357 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12779268 |
tgctaaaaaatttaccatat |
12779249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University