View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14786_low_13 (Length: 226)
Name: NF14786_low_13
Description: NF14786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14786_low_13 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 121 - 226
Target Start/End: Complemental strand, 22787742 - 22787637
Alignment:
| Q |
121 |
ttcatgggactcccctaatgtgcatctagatttaattctaggtgtttatatatgttacatatctattgtacatgttacaatccactcaacctgtaattgt |
220 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22787742 |
ttcatggggctcccctaatgtgcatctagatttaattctagttgtttatatatgttacatatctattgtacatgttacaatccactcaacctgtaattgt |
22787643 |
T |
 |
| Q |
221 |
tgctct |
226 |
Q |
| |
|
|||||| |
|
|
| T |
22787642 |
tgctct |
22787637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 15 - 67
Target Start/End: Complemental strand, 22787781 - 22787729
Alignment:
| Q |
15 |
aatcagaactcaaattcatggggtattgtataataataattcatggggctccc |
67 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22787781 |
aatcagaactcaaattcattgggtattgtataataataattcatggggctccc |
22787729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University