View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14787_high_7 (Length: 256)
Name: NF14787_high_7
Description: NF14787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14787_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 10603615 - 10603386
Alignment:
| Q |
13 |
aatattaatgttaaacacgtgttttcactacaacttaattaaatannnnnnnaaatgaaaataaaatcttcatatcctacttatttgtatcatcattgtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10603615 |
aatattaatgttaaacacgtgttttcactacaacttaattaaatattttttgaaatgaaaataaaatcttcatatcctacttatttgtatcatcattgtt |
10603516 |
T |
|
| Q |
113 |
accaccttttagtttcatagtattttattaagaaaggagaaatttaaaataatagtctttgtaaatgcattattcttgcttttagactatatcacaaaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10603515 |
accaccttttagtttcatagtattttattaagaaaggagaaatttaaaataatagtctttgtaaatgcattattcttgcttttagactatatcacaaaaa |
10603416 |
T |
|
| Q |
213 |
gaacttggtgtgtttgtaaaagaaaattat |
242 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
10603415 |
gaacttggcgtgtttgtaaaagaaaattat |
10603386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University