View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14787_high_9 (Length: 226)
Name: NF14787_high_9
Description: NF14787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14787_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 41040349 - 41040537
Alignment:
| Q |
18 |
cactttactaacatttggaaatatgatt-aatatgacaatgtatagtagtagtatatcgaaaacgtttatgtccacttgcagtggggtgtttttgttcct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41040349 |
cactttactaacatttggaaatatgatttaatatgacaatgtatagt---agtatatcgaaaacgtttatgtccacttgcagtggggcgtttttgttcct |
41040445 |
T |
 |
| Q |
117 |
gtgtatgtcttgctgctttgtgcttagtgagtgttgtggtctctttttgttgctgctagatctttattccatttggtgcacaattgtatcttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
41040446 |
gtgtatgtcttgctgctttgtgcttagtgagtgttgtggtct-tttttgttgctgctagatctttattccatttagtgcagaattgtatcttc |
41040537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University