View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14787_low_7 (Length: 335)
Name: NF14787_low_7
Description: NF14787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14787_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 10277604 - 10277684
Alignment:
| Q |
20 |
gaaaccttatttttgtgatattgcttcttgtttgtcggttttgttttatacttgtttgttggtacaattactagacatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10277604 |
gaaaccttatttttgtgatattgcttcttgtttgtcggttttgttttatacttgtttgttggtacaattactagacatttt |
10277684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 178 - 264
Target Start/End: Original strand, 34850582 - 34850668
Alignment:
| Q |
178 |
ataactttgtgatgattttttacatcaaatggtggaacccctttccgaattctgcgtatatgggagctttagtgcatcagattgtcc |
264 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||| | |||||| |
|
|
| T |
34850582 |
ataactttgtgatgactttttacatcaaatggtggaaccccttcccgaatcctgcgtatataggagctttagtgcatcgggttgtcc |
34850668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 198 - 263
Target Start/End: Complemental strand, 39499299 - 39499234
Alignment:
| Q |
198 |
tacatcaaatggtggaacccctttccgaattctgcgtatatgggagctttagtgcatcagattgtc |
263 |
Q |
| |
|
||||||||||||||| | |||||| ||||| |||||||| ||||||||||||||| ||||||||| |
|
|
| T |
39499299 |
tacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcaccagattgtc |
39499234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 198 - 253
Target Start/End: Original strand, 17623630 - 17623685
Alignment:
| Q |
198 |
tacatcaaatggtggaacccctttccgaattctgcgtatatgggagctttagtgca |
253 |
Q |
| |
|
|||| |||||||||||||||||| |||||| |||||||| ||| |||||||||||| |
|
|
| T |
17623630 |
tacaccaaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgca |
17623685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 198 - 253
Target Start/End: Original strand, 17668068 - 17668123
Alignment:
| Q |
198 |
tacatcaaatggtggaacccctttccgaattctgcgtatatgggagctttagtgca |
253 |
Q |
| |
|
|||| |||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
17668068 |
tacaccaaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgca |
17668123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 198 - 253
Target Start/End: Original strand, 5689697 - 5689752
Alignment:
| Q |
198 |
tacatcaaatggtggaacccctttccgaattctgcgtatatgggagctttagtgca |
253 |
Q |
| |
|
|||| |||||||||||||||||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
5689697 |
tacaccaaatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgca |
5689752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 253
Target Start/End: Original strand, 11394921 - 11394973
Alignment:
| Q |
201 |
atcaaatggtggaacccctttccgaattctgcgtatatgggagctttagtgca |
253 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
11394921 |
atcaaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgca |
11394973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 253
Target Start/End: Original strand, 11404648 - 11404700
Alignment:
| Q |
201 |
atcaaatggtggaacccctttccgaattctgcgtatatgggagctttagtgca |
253 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
11404648 |
atcaaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgca |
11404700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University