View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14789_high_2 (Length: 406)
Name: NF14789_high_2
Description: NF14789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14789_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 18 - 394
Target Start/End: Original strand, 39089803 - 39090176
Alignment:
| Q |
18 |
actgtcaccatgatcggcaactatgctggtaggcccttgttttatgcaggcacatgggatataatttcgtaatgcagtgctaagnnnnnnnnnnnnaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39089803 |
actgtcaccatgatcggcaactatgctggtaggcccttgttttatgcaggcacatgggatataatttcgtaatgcagtgctaagttttttctttttaatg |
39089902 |
T |
 |
| Q |
118 |
tttctcatcccaacgtttgtcagaacatgcattctgttcaaattgcataattcaatcgtgcaaaaatgggannnnnnnnnnnnnnngcacgtttagattg |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
39089903 |
tttctcatcccaacgtttttcagaacatgcattctgttcaaattacataattcaaacgtgcaaaaatgggatttttttttttt---gcacgtttagattg |
39089999 |
T |
 |
| Q |
218 |
tgtgatccagacaaaacacatgtttcaagaaatgttgggaggggagaagagaagtcatcnnnnnnnnnnnnnnnnnnaggtattgcttgtggatacacaa |
317 |
Q |
| |
|
||| ||||| |||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
39090000 |
tgtaatccatacaaaacacatgtttcgagaaatgttgggaggggagaaaagaagtcatcttttcgtttttgttttttaggtattgcttgtggatacacaa |
39090099 |
T |
 |
| Q |
318 |
atccactacaaggaatagggaaatatgcaaggactattcacgagcctggttgtgcgaatgtggcatgcaatgatgat |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39090100 |
gtccactacaaggaatagggaaatatgcaaggactattcacgagcccggttgtgcgaatgtggcatgcaatgatgat |
39090176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University