View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14790_high_1_N (Length: 431)
Name: NF14790_high_1_N
Description: NF14790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14790_high_1_N |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 20 - 406
Target Start/End: Complemental strand, 14791581 - 14791188
Alignment:
| Q |
20 |
gacacatgtggagaaattcgccacatgcatgcactaaaggcaaaataatttctatttttagaaaaagggaaaatagtttgaggcaagtacttgaaaaata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791581 |
gacacatgtggagaaattcgccacatgcatgcactaaaggcaaaataatttctatttttagaaaaagggaaaatagtttgaggcaagtacttgaaaaata |
14791482 |
T |
 |
| Q |
120 |
tttcatatcatgcattaagagagcaaaggtcaagtaaaaggagaataattccaccac-------agtgagaatatgatttgtgatcaaagcgtgggttct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791481 |
tttcatatcatgcattaagagagcaaaggtcaagtaaaaggagaataattccaccacgtccagtagtgagaatatgatttgtgatcaaagcgtgggttct |
14791382 |
T |
 |
| Q |
213 |
gtttcatccagcgatgccaatggctggcataatgtgatcgttctttcaaaagtatactagttattttagtagagttttcttaaactttcattgcaattat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791381 |
gtttcatccagcgatgccaatggctggcataatgtgatcgttctttcaaaagtatactagttattttagtagagttttcttaaactttcattgcaattat |
14791282 |
T |
 |
| Q |
313 |
cccttttattttactattggatgtaagtatgcttatgttaattagcattctgattatgaactcttccatcaattgtctttacaacatatattgt |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14791281 |
cccttttattttactattggatgtaagtatgcttatgttaattagcattctgattatgaactcttccatcaattgtctttacaacacatattgt |
14791188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University