View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14791_high_22 (Length: 212)
Name: NF14791_high_22
Description: NF14791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14791_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 180
Target Start/End: Original strand, 33298373 - 33298533
Alignment:
| Q |
20 |
tcttgatccatgagacaatttttacaaccatggcatgctgtttttgaaccttggaatttgtttaactaatgcatgatattgtgtaatgtattctacgtag |
119 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33298373 |
tcttgatccatgagaccatttttacaaccatggcatgctgttgttgaaccttggaatttgtttaactaatgcatgatattgtgtaatgtattctacgtag |
33298472 |
T |
 |
| Q |
120 |
ttactgattacatgtaactctttctcaataagacacaaacatagttacgtggacctttccc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33298473 |
ttactgattacatgtaactctttctcaataagacacaaacatagttacgtggacctttccc |
33298533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University