View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14791_low_16 (Length: 276)
Name: NF14791_low_16
Description: NF14791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14791_low_16 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 31105922 - 31106197
Alignment:
| Q |
1 |
ctagaaagttgttataaatatagagttatattgagttttcttcgccccgaacatccctagtctattgattgtacttggggcttgggtagttgtgtgtctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
31105922 |
ctagaaagttgttataaatatagagttatattgagttttcttcaccccgaacatccctagtctactggttgtacttggggcttgggtagttgtgtgtctt |
31106021 |
T |
|
| Q |
101 |
gagagagtttacaacttttccgtgcaaaatcaaattcattttatctaactaacatttgtgaaatagaaaatgtcatttgcacctaactaggctgtgttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31106022 |
gagagagtttacaacttttccgtgcaaaatcaaactcattttatctaactaacatttgtgaaatagaaaatgtcatttgcatctaactaggctgtgttaa |
31106121 |
T |
|
| Q |
201 |
aggatataataatgtgatctaaaaaatgtcattctatccaaaaatttcttttatcattaaaatgaacagcatttca |
276 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31106122 |
aggatataatgatgtgatctaaaaaatgtaattctatccaaaaatttcttttatcattaaaatgaacagcatttca |
31106197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 211
Target Start/End: Original strand, 31107828 - 31107895
Alignment:
| Q |
140 |
tttatctaactaacatttgtgaaatagaaaatgtcatttgcacctaactaggctgtgttaaaggatataata |
211 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
31107828 |
tttatctaactaacatttgtgcaatagaaaatgtcatctgcac----agaggctgtgttaaaggatataata |
31107895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 3511763 - 3511677
Alignment:
| Q |
22 |
agagttatattgagttttcttcgccccgaacatccctagtctattgattgtacttggggcttgggtagttgtgtgtcttgagagagttt |
110 |
Q |
| |
|
||||||||||||||||||| || || | |||| | ||||||| ||| |||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3511763 |
agagttatattgagttttcatcaccac-aacaactctagtcttttgggtgta-ttggggattgggtagttgtgtgtcttgagagagttt |
3511677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University