View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14791_low_20 (Length: 239)
Name: NF14791_low_20
Description: NF14791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14791_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 20 - 169
Target Start/End: Complemental strand, 29820415 - 29820266
Alignment:
| Q |
20 |
ggatggtcgagttcgtgggagtggtgttggttatccaccttggaatgctttcgttgcacaattaccgccggtaaagggaatctggactggcctactagat |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29820415 |
ggatggtcgagttcgtggaagtggtgttggttatccaccttggaatgctttcgttgcacaattaccgccggtaaagggaatctggactggcctactagat |
29820316 |
T |
|
| Q |
120 |
ggcatggatggcagagtttagaagttcttttccatactcttgaaggatga |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29820315 |
ggcatggatggcagagtttagaagttcttttccatactcttgaaggatga |
29820266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 29820255 - 29820219
Alignment:
| Q |
186 |
atatacttctcccccttatacaaggagttcagcccta |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29820255 |
atatactcctcccccttatacaaggagttcagcccta |
29820219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University