View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14791_low_22 (Length: 235)
Name: NF14791_low_22
Description: NF14791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14791_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 88 - 216
Target Start/End: Complemental strand, 42117579 - 42117451
Alignment:
| Q |
88 |
tttgttttgttcatgttatgtaaaagaggcttatatagtgaagaagagacaaggtctaaagcattgaagactataattgatgtagaggagatcgacctaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42117579 |
tttgttttgttcatgttatgtaaaagaggcttatatagtgaagaagagacaaggtctaaagcattgaagactataattgatgtagaggagatcgacctaa |
42117480 |
T |
|
| Q |
188 |
tcatatatggcttggtttaaagagtttgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42117479 |
tcatatatggcttggtttaaagagtttgc |
42117451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University