View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14791_low_23 (Length: 229)
Name: NF14791_low_23
Description: NF14791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14791_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 10 - 152
Target Start/End: Original strand, 45761758 - 45761902
Alignment:
| Q |
10 |
acatcatcaccagatcactcgctccgcgcctcaagcaattttcaccttatagttttaatctgtcaaactggaaatctaataccacagcttggt--tgtgt |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
45761758 |
acatcatcaccagatcactcgctccacgcctcaagcaattttcaccttatagttttaatctgtcaaactggaaatttaataccacagcttggttgtgtgt |
45761857 |
T |
|
| Q |
108 |
ttgtgcgtgaatttaagcttttatccagaccgacataacatacat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45761858 |
ttgtgcgtgaatttaagcttttatccagaccgacataacatacat |
45761902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 174 - 210
Target Start/End: Original strand, 45761904 - 45761940
Alignment:
| Q |
174 |
cacccattccatgcatattaagagcaattgagttgac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45761904 |
cacccattccatgcatattaagagcaattgagttgac |
45761940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University