View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14793_high_25 (Length: 241)
Name: NF14793_high_25
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14793_high_25 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 116 - 241
Target Start/End: Original strand, 43007658 - 43007782
Alignment:
| Q |
116 |
tagcctgtagtatgaattgtgttaatgaaaaagtattaaaaattaggttcaaagtttacttctaactagcctagctatgactatnnnnnnnntattgtaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| | |
|
|
| T |
43007658 |
tagcctgtagtatgaattgtgttaattaaaaagtattaaaaattaggttcaaagtttacttctaactagccttgctatgactataaaaaaaatattgt-a |
43007756 |
T |
 |
| Q |
216 |
aaagacgtaacgcaatttgtcatttt |
241 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
43007757 |
aaagacgtaacgcaatttatcatttt |
43007782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 4 - 87
Target Start/End: Original strand, 43007576 - 43007659
Alignment:
| Q |
4 |
gaattagaaagtgaaatttttgacaaatgatcatgtgatgattgnnnnnnnngagaccgataaaaagatagatgaggctagtta |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43007576 |
gaattagaaagtgaaatttttgacaaatgatcatgtgatgattgaaaaaaaagagaccgataaaaagatagatgaggctagtta |
43007659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University