View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14793_high_27 (Length: 239)

Name: NF14793_high_27
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14793_high_27
NF14793_high_27
[»] chr5 (2 HSPs)
chr5 (19-84)||(42264665-42264730)
chr5 (174-228)||(42264819-42264873)


Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 42264665 - 42264730
Alignment:
19 aggatttcgtccgtttcttcattctctttgtttgctttgcaactcaggtgtgctagagagtctgtg 84  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
42264665 aggatttcgtctgtttcttcattctctttgtttgctttgcaactcaggtgtgctagagagtttgtg 42264730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 174 - 228
Target Start/End: Original strand, 42264819 - 42264873
Alignment:
174 cttgtgtagccctgttaaacgtgacttttgcttgtctctgctttggtttgttcat 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42264819 cttgtgtagccctgttaaacgtgacttttgcttgtctctgctttggtttgttcat 42264873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University