View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14793_high_33 (Length: 221)

Name: NF14793_high_33
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14793_high_33
NF14793_high_33
[»] chr7 (1 HSPs)
chr7 (18-206)||(43099194-43099386)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 43099386 - 43099194
Alignment:
18 tgattaagatggatgggttgtttcatccgagtgaatatcacttgaaggttacatgcaaacctttgaactttggaattccatcgtccaacattaacaacgt 117  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43099386 tgattaagatggatgggttgtttcatccgagtgaatatcgcttgaaggttacatgcaaacctttgaactttggaattccatcgtccaacattaacaacgt 43099287  T
118 tacttgggaattattgggtagtgtagcatgttaatgatttaacaatggattag----ggagtgtgcatgttcaatgttttaatttgtgttcat 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||    
43099286 tacttgggaattattgggtagtgtagcatgttaatgatttaacaatggattaggggtggagtgtgcatgttcaatgttttaatttgtgttcat 43099194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University