View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14793_low_17 (Length: 353)
Name: NF14793_low_17
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14793_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 2e-74; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 9394487 - 9394334
Alignment:
| Q |
1 |
gcaactgtgtttttatgttattttgtttgattttatgttgagaattttctgctttagggtttattcatatgatttcgtgttgaaaattgggttttagtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394487 |
gcaactgtgtttttatgttattttgtttgattttatgttgaaaattttcttctttagggtttattcatatgatttcgtgttgaaaattgggttttagtgt |
9394388 |
T |
|
| Q |
101 |
ttatttcttttattgcatgttggaaattctgtttctattttaattatgttgaaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9394387 |
ttatttcttttattgcatgttggaaattctgtttctattttatttatgttgaaa |
9394334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 186 - 348
Target Start/End: Complemental strand, 9394314 - 9394152
Alignment:
| Q |
186 |
atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcatttctttgatttggtgatggaaattatgnnnnnnnnnnnnngattcatgtt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9394314 |
atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcatttctttgatttggtgatggaaattatgttttttattttttgattcatgtt |
9394215 |
T |
|
| Q |
286 |
aaaattttggttctaggttcctttcttttgatttaatgttgaaaattgtgtttttggattcat |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394214 |
gaaattttggttctaggttcctttcttttgatttaatgttgaaaattgtgtttttggattcat |
9394152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 207 - 262
Target Start/End: Complemental strand, 9394066 - 9394011
Alignment:
| Q |
207 |
catgttgaaaactgtgttttatggttcatttctttgatttggtgatggaaattatg |
262 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| |||| |||||| |
|
|
| T |
9394066 |
catgttgaaaactgtgttttaggattcatttctttgatttggtgttggagattatg |
9394011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 203 - 262
Target Start/End: Complemental strand, 9394184 - 9394125
Alignment:
| Q |
203 |
atttcatgttgaaaactgtgttttatggttcatttctttgatttggtgatggaaattatg |
262 |
Q |
| |
|
|||| |||||||||| |||||||| | |||||||||||||||||||| ||||||||||| |
|
|
| T |
9394184 |
atttaatgttgaaaattgtgtttttggattcatttctttgatttggtgttggaaattatg |
9394125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 348
Target Start/End: Complemental strand, 9394108 - 9394038
Alignment:
| Q |
278 |
ttcatgttaaaattttggttctaggttcctttcttttgatttaatgttgaaaattgtgtttttggattcat |
348 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||| |||||| |||||||||| |||||||| |||||||| |
|
|
| T |
9394108 |
ttcatgttgaaaatttggttttaggttccttttatttgataccatgttgaaaactgtgttttaggattcat |
9394038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 65
Target Start/End: Complemental strand, 1342003 - 1341951
Alignment:
| Q |
13 |
ttatgttattttgtttgattttatgttgagaattttctgctttagggtttatt |
65 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| | ||||||||||||| |
|
|
| T |
1342003 |
ttatgttattttgtttgattttatgttcaaaattttgttttttagggtttatt |
1341951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 241
Target Start/End: Complemental strand, 31943688 - 31943650
Alignment:
| Q |
203 |
atttcatgttgaaaactgtgttttatggttcatttcttt |
241 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31943688 |
atttcatgttgaaaaatgtgttttagggttcatttcttt |
31943650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 12 - 41
Target Start/End: Complemental strand, 31943936 - 31943907
Alignment:
| Q |
12 |
tttatgttattttgtttgattttatgttga |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31943936 |
tttatgttattttgtttgattttatgttga |
31943907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University