View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14793_low_18 (Length: 315)
Name: NF14793_low_18
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14793_low_18 |
 |  |
|
| [»] scaffold0699 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0699 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0699
Description:
Target: scaffold0699; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 31 - 315
Target Start/End: Original strand, 2141 - 2424
Alignment:
| Q |
31 |
tatttacacacactatcaatgtcaaataccatcacaaaatgagttcatgatcacacattgtgtgatcagaatgttatctttaagccttnnnnnnnnnnnn |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2141 |
tatttacacacactatcaatgtcaaataccaacacaaaatgagttcatgatcacacattgtgtgatcagaattttatctttaagccttaaaaaaaaaaa- |
2239 |
T |
 |
| Q |
131 |
gttgtcttaagaaccagctccaagagggggatttaataatacccaccaataagagtacaaatgtctccggctcccaagaagatgctagcattacgggatc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
2240 |
gttgtcttaagaaccagctccaagagggggatttaataatacccaccaataagagtacaaatgtctctggctcccaagaagatgctagcattatgggatc |
2339 |
T |
 |
| Q |
231 |
tctccacaaggaccacacaacaatttatcagacaaatatgaaacctaacccaagtccaaccaaataataagcagacgcgttaaat |
315 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||| |
|
|
| T |
2340 |
tctccacaaggatcacacaacaatttatcagacaaatatgaaacctaacccaaatccaactaaataataagcagactcgttaaat |
2424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University