View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14793_low_20 (Length: 310)
Name: NF14793_low_20
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14793_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 39750540 - 39750395
Alignment:
| Q |
1 |
tctttcttctttttaataaataattcaaatttttagaatgttcatggttgnnnnnnngcattctaattttcaggtgttggtggctatggctatttgcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39750540 |
tctttcttctttttaataaataattcaattttttagaatgttcatggttgtttttttgcattctaattttcaggtgttggtggctatggctatttgcttc |
39750441 |
T |
|
| Q |
101 |
aacctctctggtgggtcggaatggttactagtatgtacctttgtac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39750440 |
aacctctctggtgggtcggaatggttactagtatgtacctttgtac |
39750395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 199 - 294
Target Start/End: Complemental strand, 39750341 - 39750246
Alignment:
| Q |
199 |
acttggtgattatgtaacagtgattgttggagagatagctaattttgtagcatacatgtacgcccctgctgtgcttgtcactccattaggtgcttt |
294 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39750341 |
acttggtgattttgtaacagtgattgttggagagatagctaattttgtagcatacatgtacgcccctgctgtgcttgtcactccattaggtgcttt |
39750246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 68 - 132
Target Start/End: Complemental strand, 44564286 - 44564222
Alignment:
| Q |
68 |
tttcaggtgttggtggctatggctatttgcttcaacctctctggtgggtcggaatggttactagt |
132 |
Q |
| |
|
||||||| || || |||||||||||| | ||||||||||| |||||| |||| |||||||||||| |
|
|
| T |
44564286 |
tttcaggcgtcggaggctatggctatcttcttcaacctctttggtggatcggcatggttactagt |
44564222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 294
Target Start/End: Complemental strand, 44564144 - 44564066
Alignment:
| Q |
216 |
cagtgattgttggagagatagctaattttgtagcatacatgtacgcccctgctgtgcttgtcactccattaggtgcttt |
294 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||| || || || || || ||||| |||||| | |||||||| |
|
|
| T |
44564144 |
cagtgattgttggagaaattgcgaattttgtagcatacatttatgcgccggcggttcttgttactccacttggtgcttt |
44564066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University