View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14793_low_25 (Length: 295)
Name: NF14793_low_25
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14793_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 42198266 - 42198018
Alignment:
| Q |
18 |
caccaaacatgttatgttatttctcattggttgtgtaacatgcatgcacttaggtcttagtcacatatccataatggatattggattgcatgcatgaact |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42198266 |
caccaaacatgttctgttatttctcattggttgtgtaacatgcatgcacttaggtcttagtcacatat-------------tggattgcatgcatgaact |
42198180 |
T |
 |
| Q |
118 |
caacatgtttgggtttgctttatgcaacttgattgagcacgtggtcaagtagagtcaacaatacttccactctatctctaaatatatgattattttttnn |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42198179 |
caacatgtttgggtttgctttatgcaacttgattgagcacgtggtcaagtagagtcaacaatacttccactctatctctaaatatatgattattttttta |
42198080 |
T |
 |
| Q |
218 |
nnnnnnttaaataaacttatcccttttaatacagcttctctttcaaattttccaaagtatta |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42198079 |
aaaaaattaaataaacttatcccttttaatacagctcctctttcaaattttccaaagtatta |
42198018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University