View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14793_low_35 (Length: 239)
Name: NF14793_low_35
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14793_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 42264665 - 42264730
Alignment:
| Q |
19 |
aggatttcgtccgtttcttcattctctttgtttgctttgcaactcaggtgtgctagagagtctgtg |
84 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42264665 |
aggatttcgtctgtttcttcattctctttgtttgctttgcaactcaggtgtgctagagagtttgtg |
42264730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 174 - 228
Target Start/End: Original strand, 42264819 - 42264873
Alignment:
| Q |
174 |
cttgtgtagccctgttaaacgtgacttttgcttgtctctgctttggtttgttcat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42264819 |
cttgtgtagccctgttaaacgtgacttttgcttgtctctgctttggtttgttcat |
42264873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University