View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14793_low_37 (Length: 235)
Name: NF14793_low_37
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14793_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28267248 - 28267469
Alignment:
| Q |
1 |
agtagtccagcatactaaaggattagggtcatctgccaagagaacatccccacgttttctagatggaactctgtttaattt--gtgtttataaatccatt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||| ||||||| |||||||| |
|
|
| T |
28267248 |
agtagtccagcatactaaaggattagggtcatctgccaagagaacatccccaagttttctagatggaattgtgtttaatttttgtgtttacgaatccatt |
28267347 |
T |
|
| Q |
99 |
tggagttggtctagcagttggcatgagactttagaatgtgccctcttaaaatctcagttccgattttccctgaccccatttcagtaggttaaatctatgc |
198 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
28267348 |
tg-agttggtctagcagttggcatgagactttagagtgtgccctcttaaggtctcagttccgattttccctgaccccatttcagtgagttaaatttatgc |
28267446 |
T |
|
| Q |
199 |
aaagctacactttatctttgaat |
221 |
Q |
| |
|
|||| ||| |||||||||||||| |
|
|
| T |
28267447 |
aaagttacgctttatctttgaat |
28267469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University