View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14793_low_39 (Length: 229)
Name: NF14793_low_39
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14793_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 2873609 - 2873803
Alignment:
| Q |
16 |
aatatgattatgattatgggtgaaaattgatgtccatacatgcaatggaacacccttttaatttggggattaatttaacataacttgcataatttannnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2873609 |
aatatgattatgattatgggtgaaaattgatgtccatacatgcaatggaacacccttttaatttggggattaatttaacataacttgcataatttatttt |
2873708 |
T |
|
| Q |
116 |
nnnnnnnnnngtgatgcatagatttgctatctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtctacatg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2873709 |
ttatttttttgtgatgcatagatttgctatctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtctacatg |
2873803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 205
Target Start/End: Complemental strand, 2901455 - 2901395
Alignment:
| Q |
145 |
tctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtct |
205 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||| | |||||||||||||||||||||| |
|
|
| T |
2901455 |
tctgagttgtctagaagagaaaaggaagcaaagattaagccagacccagatattgatgtct |
2901395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 44214098 - 44214028
Alignment:
| Q |
140 |
tgctatctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtctacatg |
210 |
Q |
| |
|
||||||||||| | | ||||||||| || | |||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
44214098 |
tgctatctgagctttctagaagagagaaggtagcaaatatcaagcctgacccagatattgatgtctacatg |
44214028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University