View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14793_low_40 (Length: 226)
Name: NF14793_low_40
Description: NF14793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14793_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 31204188 - 31204382
Alignment:
| Q |
17 |
cagaagattcacttaaaccatctttgatacagcagaagttgaagtgaggatagtttgatgggttaagggaattaaaacttgtgtgaatgatggttatgga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31204188 |
cagaagattcacttaaaccatctttgatacaacagaagttgaagtgaggatagtttgatgggttaagggaattaaaacttgtgtgaatgatggttatgga |
31204287 |
T |
 |
| Q |
117 |
aaaaccatttgagtaaaggatttgtgcaagttgaagcattggatttatgtgtccttgtaatggtaaagggataagtaacaatctacaaccctttg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31204288 |
aaaaccatttgagtaaaggatttgtgcaagttgaagcattggatttatgtgtccttgtaatggtaaagggataagtaacaatctacaaccctttg |
31204382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 179
Target Start/End: Original strand, 30848202 - 30848234
Alignment:
| Q |
147 |
ttgaagcattggatttatgtgtccttgtaatgg |
179 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
30848202 |
ttgaagcattggatttatgtgaccttgtaatgg |
30848234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University