View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14794_high_19 (Length: 234)
Name: NF14794_high_19
Description: NF14794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14794_high_19 |
 | |
|
| [»] chr1 (5 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 52322052 - 52322265
Alignment:
| Q |
16 |
atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacataatttagagaagccttcaattcaaggatcaaaattttccaactg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52322052 |
atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacataatttagagaagccttca-----aggatcaaaattttccaactg |
52322146 |
T |
|
| Q |
116 |
gcgctagtgttttctacaaacaatcaccaactggaacattaggggttagtataatgtacatgagcacataaaatttaaaagtctaatatctcaacaatat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52322147 |
gcgctagtgttttctacaaacaatcaccaactggaacattaggggttagtataatttacatgagcacataaaatttaaaagtctaatatctcaacaatat |
52322246 |
T |
|
| Q |
216 |
gtgcactaatttgattttt |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52322247 |
gtgcactaatttgattttt |
52322265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 52325166 - 52325222
Alignment:
| Q |
16 |
atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacata |
72 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
52325166 |
atatgtgagaaaggtgtcagaaaattgcattgcccatatgaaatctgaaggaacata |
52325222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 52332832 - 52332888
Alignment:
| Q |
16 |
atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacata |
72 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
52332832 |
atatgtgagaaaggtgtcagaaaattgcattgcccatatgaaatctgaaggaacata |
52332888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 52329596 - 52329652
Alignment:
| Q |
16 |
atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacata |
72 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| ||||||||| ||| |||||||| |
|
|
| T |
52329596 |
atatgtgagaaaggtgtcagaaaattgcattgcccatatgaaatttgaaggaacata |
52329652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 167
Target Start/End: Original strand, 52329696 - 52329772
Alignment:
| Q |
91 |
ttcaaggatcaaaattttccaactggcgctagtgttttctacaaacaatcaccaactggaacattaggggttagtat |
167 |
Q |
| |
|
||||||| |||| ||||||| | || ||| ||||||||| || ||||||||||| |||| |||||||||||||||| |
|
|
| T |
52329696 |
ttcaaggttcaattttttccaccaggggctggtgttttcttcagacaatcaccaaatggagcattaggggttagtat |
52329772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 9179293 - 9179349
Alignment:
| Q |
16 |
atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacata |
72 |
Q |
| |
|
||||||||| ||||| ||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
9179293 |
atatgtgagaaaggtatcagaaaattgcattgcccatatgaaatctgaaggaacata |
9179349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 167
Target Start/End: Original strand, 9179381 - 9179420
Alignment:
| Q |
128 |
tctacaaacaatcaccaactggaacattaggggttagtat |
167 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9179381 |
tctacagacaatcaccaaatggaacattaggggttagtat |
9179420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University