View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14794_high_20 (Length: 231)

Name: NF14794_high_20
Description: NF14794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14794_high_20
NF14794_high_20
[»] chr7 (1 HSPs)
chr7 (17-214)||(41125400-41125597)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 41125400 - 41125597
Alignment:
17 atgattaatagtatagattcggtggataagcataaaacatttggggacaattgcatgtgagttttcattaatggtaagtgtcactgtttctcccattttg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41125400 atgattaatagtatagattcggtggataagcataaaacatttggggacaattgcatgtgagttttcattaatggtaagtgtcactgtttctcccattttg 41125499  T
117 gggacgaagttagcaatgtacttgcatgaatcattattcatgctcactaaatgtaagagggaaaacgtatatctacatggagaagtagacagaaagta 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41125500 gggacgaagttagcaatgtacttgcatgaatcattattcatgctcactaaatgtaagagggaaaacgtatatctacatggagaagtagacagaaagta 41125597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University