View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14794_low_19 (Length: 243)
Name: NF14794_low_19
Description: NF14794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14794_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 70 - 238
Target Start/End: Complemental strand, 49222045 - 49221877
Alignment:
| Q |
70 |
caatttgtcgcgtttgaacacttgggtttaggttgtagaataggtagttgtgttgagatacggtcttgtgctggcatgttggnnnnnnnaacatctcaaa |
169 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49222045 |
caatttgtcgtgtttgaacacttgagtttaggttgtagaataggtagttgtgttgagatacggtcttgtgctggcatgttggtttttttaacatctcaaa |
49221946 |
T |
 |
| Q |
170 |
aaccatttttgttgaatttaaattttttgattcctgtagtgttttcttgtttctctccatggcccattc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
49221945 |
aaccatttttgttgaatttaaattttttgattcctgtagtgttttcttgtttctctccctgacccattc |
49221877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University