View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14794_low_19 (Length: 243)

Name: NF14794_low_19
Description: NF14794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14794_low_19
NF14794_low_19
[»] chr3 (1 HSPs)
chr3 (70-238)||(49221877-49222045)


Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 70 - 238
Target Start/End: Complemental strand, 49222045 - 49221877
Alignment:
70 caatttgtcgcgtttgaacacttgggtttaggttgtagaataggtagttgtgttgagatacggtcttgtgctggcatgttggnnnnnnnaacatctcaaa 169  Q
    |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||    
49222045 caatttgtcgtgtttgaacacttgagtttaggttgtagaataggtagttgtgttgagatacggtcttgtgctggcatgttggtttttttaacatctcaaa 49221946  T
170 aaccatttttgttgaatttaaattttttgattcctgtagtgttttcttgtttctctccatggcccattc 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||    
49221945 aaccatttttgttgaatttaaattttttgattcctgtagtgttttcttgtttctctccctgacccattc 49221877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University