View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14794_low_21 (Length: 239)
Name: NF14794_low_21
Description: NF14794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14794_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3705631 - 3705411
Alignment:
| Q |
1 |
cagtgtaagttgatattgtaggcatacatagtgggggaacatggtgacagttcagtggcattatggtcaagcattagtgtcggaggtgttccagtgctaa |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3705631 |
cagtttaagttgatattgtaggcatacatagtgggggaacatggtgatagttcagtggcattatggtcaagcattagtgtcggaggtgttccagtgctaa |
3705532 |
T |
 |
| Q |
101 |
gctttttggagaaacaacaaatagcttatgagaaagaaatgctagagaacatacataaggaggttataaacggcgcatatgaagtgatcagtttaaaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3705531 |
gctttttggagaaacaacaaatagcttatgagaaagaaatgctagagaacatacataaggaggttataaacggcgcatatgaagtgatcagtttaaaagg |
3705432 |
T |
 |
| Q |
201 |
gtacacttcttgggctatagg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3705431 |
gtacacttcttgggctatagg |
3705411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 20 - 215
Target Start/End: Original strand, 41766487 - 41766682
Alignment:
| Q |
20 |
aggcatacatagtgggggaacatggtgacagttcagtggcattatggtcaagcattagtgtcggaggtgttccagtgctaagctttttggagaaacaaca |
119 |
Q |
| |
|
|||||| |||||| ||||| ||||| || |||||||| ||||| ||||| || || || | || ||| |||| ||||| || ||||||||||||||||| |
|
|
| T |
41766487 |
aggcatgcatagtaggggagcatggggatagttcagtagcattgtggtctagtatcagcattggtggtattcccgtgctgagttttttggagaaacaaca |
41766586 |
T |
 |
| Q |
120 |
aatagcttatgagaaagaaatgctagagaacatacataaggaggttataaacggcgcatatgaagtgatcagtttaaaagggtacacttcttgggc |
215 |
Q |
| |
|
|| || ||||||||||||| || ||||| ||||| ||| || |||||| |||| |||||||| |||||| ||||||| |||||||| ||||| |
|
|
| T |
41766587 |
gattgcatatgagaaagaaacactggagaatatacacaagactgtgataaacagcgcttatgaagtcatcagtctaaaaggctacacttcatgggc |
41766682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University