View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14794_low_22 (Length: 234)

Name: NF14794_low_22
Description: NF14794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14794_low_22
NF14794_low_22
[»] chr1 (5 HSPs)
chr1 (16-234)||(52322052-52322265)
chr1 (16-72)||(52325166-52325222)
chr1 (16-72)||(52332832-52332888)
chr1 (16-72)||(52329596-52329652)
chr1 (91-167)||(52329696-52329772)
[»] chr7 (2 HSPs)
chr7 (16-72)||(9179293-9179349)
chr7 (128-167)||(9179381-9179420)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 52322052 - 52322265
Alignment:
16 atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacataatttagagaagccttcaattcaaggatcaaaattttccaactg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||    
52322052 atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacataatttagagaagccttca-----aggatcaaaattttccaactg 52322146  T
116 gcgctagtgttttctacaaacaatcaccaactggaacattaggggttagtataatgtacatgagcacataaaatttaaaagtctaatatctcaacaatat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
52322147 gcgctagtgttttctacaaacaatcaccaactggaacattaggggttagtataatttacatgagcacataaaatttaaaagtctaatatctcaacaatat 52322246  T
216 gtgcactaatttgattttt 234  Q
    |||||||||||||||||||    
52322247 gtgcactaatttgattttt 52322265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 52325166 - 52325222
Alignment:
16 atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacata 72  Q
    ||||||||| ||||||||||||||||| |||||  ||||||||||||| ||||||||    
52325166 atatgtgagaaaggtgtcagaaaattgcattgcccatatgaaatctgaaggaacata 52325222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 52332832 - 52332888
Alignment:
16 atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacata 72  Q
    ||||||||| ||||||||||||||||| |||||  ||||||||||||| ||||||||    
52332832 atatgtgagaaaggtgtcagaaaattgcattgcccatatgaaatctgaaggaacata 52332888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 52329596 - 52329652
Alignment:
16 atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacata 72  Q
    ||||||||| ||||||||||||||||| |||||  ||||||||| ||| ||||||||    
52329596 atatgtgagaaaggtgtcagaaaattgcattgcccatatgaaatttgaaggaacata 52329652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 167
Target Start/End: Original strand, 52329696 - 52329772
Alignment:
91 ttcaaggatcaaaattttccaactggcgctagtgttttctacaaacaatcaccaactggaacattaggggttagtat 167  Q
    ||||||| ||||  ||||||| | || ||| ||||||||| || ||||||||||| |||| ||||||||||||||||    
52329696 ttcaaggttcaattttttccaccaggggctggtgttttcttcagacaatcaccaaatggagcattaggggttagtat 52329772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 9179293 - 9179349
Alignment:
16 atatgtgaggaaggtgtcagaaaattgtattgcttatatgaaatctgatggaacata 72  Q
    ||||||||| ||||| ||||||||||| |||||  ||||||||||||| ||||||||    
9179293 atatgtgagaaaggtatcagaaaattgcattgcccatatgaaatctgaaggaacata 9179349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 167
Target Start/End: Original strand, 9179381 - 9179420
Alignment:
128 tctacaaacaatcaccaactggaacattaggggttagtat 167  Q
    |||||| ||||||||||| |||||||||||||||||||||    
9179381 tctacagacaatcaccaaatggaacattaggggttagtat 9179420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University