View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14794_low_25 (Length: 206)
Name: NF14794_low_25
Description: NF14794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14794_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 17 - 164
Target Start/End: Original strand, 7872839 - 7872985
Alignment:
| Q |
17 |
cagagagggaaagagttaggaattagatttagagactaagatttttgtttggctaccacaaaaatcacttgatgctatttgaacgtgaattttaaaatta |
116 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7872839 |
cagagagggaaagggttaggaattagatttagagactgagatttttgtttggctaccacaaaaatcact-gatgctatttgaacgtgaattttaaaatta |
7872937 |
T |
|
| Q |
117 |
gtttagaactttcatttttttcagctcaatatgagtttgtttccttga |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7872938 |
gtttagaactttcatttttttcagctcaatatgagtttgttttcttga |
7872985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 123 - 164
Target Start/End: Complemental strand, 7475876 - 7475835
Alignment:
| Q |
123 |
aactttcatttttttcagctcaatatgagtttgtttccttga |
164 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||| |||| |
|
|
| T |
7475876 |
aactttcctttttttaagctcaatatgagtttgtttcattga |
7475835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University