View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14796_low_10 (Length: 237)
Name: NF14796_low_10
Description: NF14796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14796_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 10339842 - 10339622
Alignment:
| Q |
1 |
gtgctaagtaagcaactaatctataaccaaacaacatcaaggccatgatgaacacatcaacccacatatgattcaatcccattgatttaattggaggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10339842 |
gtgctaagtaagcaactaatctataaccaaacaacatcaaggccatgatgaacacatcaacccacatatgattcaatcccattgatttaattggaggaaa |
10339743 |
T |
|
| Q |
101 |
gtccataaccttgcacaactctccctttgaacattcatagtaatcattttcattgtattgaacaccaagaagaagcttgtaacagtagtagctatagctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10339742 |
gtccataaccttgcacaactctccctttgaacattcatagtaatcattttcattgtattgaacaccaagaagaagcttgtaacagtagtagctatagctt |
10339643 |
T |
|
| Q |
201 |
aagtacttaagccaaactatg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10339642 |
aagtacttaagccaaactatg |
10339622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University