View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14796_low_12 (Length: 207)
Name: NF14796_low_12
Description: NF14796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14796_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 9 - 197
Target Start/End: Original strand, 21535968 - 21536156
Alignment:
| Q |
9 |
catcacagaagagtttgtgactatgatggaaggtggtagctgcactgccaacagcaaaaatgtagaaaagtttgcgactacgatggaggatggcagcacc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21535968 |
catcacagaagagtttgtgactatgatggaaggtggtagctgcaccgccaacagcaaaaatgtagaagagtttgcgactacgatggaggatggcagcacc |
21536067 |
T |
 |
| Q |
109 |
acccccaccaacaaggcagaagagattgtgatgataatggatggtgtcagcatccccaccaccgacaataacaatgcagaaaagtttgg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21536068 |
acccccaccaacaaggcagaagagattgtgatgataatggatggtgtcagcatccccaccaccgacaataacaatgcagaaaagtttgg |
21536156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University