View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14796_low_7 (Length: 266)
Name: NF14796_low_7
Description: NF14796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14796_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 42 - 249
Target Start/End: Complemental strand, 20268001 - 20267794
Alignment:
| Q |
42 |
caaaggcgaagtatacatacagctaggacagtgttacagaagttgcaacgaacgtaacaaaggtgttgatcagaaggtggaaccaagtccatggtaactt |
141 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20268001 |
caaaggtgaagtatacatacagctaggacagtgttacagaagttgcaacgaacgtaacaaaggtgttgatcagaaggtggaaccaagtccatggtaactt |
20267902 |
T |
|
| Q |
142 |
tctcttcatggttcatgtttcaaaggatgcaaagaaaagggtaagtataggttttagtagagggagaagatttttgagataggaaattgtaaagatgagt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
20267901 |
tctcttcatggttcatgtttcaaaggatgcaaagaaaagagtaagtataggttttagtagagggagaagatttttgagataggaaattgtaaagataagt |
20267802 |
T |
|
| Q |
242 |
ggagtgat |
249 |
Q |
| |
|
|||||||| |
|
|
| T |
20267801 |
ggagtgat |
20267794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University